EST details — SGN-C81885

Search information 
Request: 81885Match: SGN-C81885
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C81885Clone name: cLET-18-L9
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C183566 is on microarray TOM1: SGN-S1-1-5.1.2.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183566 [TUS-42-I4] Trace: SGN-T195037 EST: SGN-E393711 Direction: 3' Facility: INRA
Clone: SGN-C183566 [TUS-42-I4] Trace: SGN-T195038 EST: SGN-E393712 Direction: 5' Facility: INRA
Clone: SGN-C183566 [TUS-42-I4] Trace: SGN-T195038 EST: SGN-E399269 Direction: 5' Facility: INRA
Clone: SGN-C183566 [TUS-42-I4] Trace: SGN-T195039 EST: SGN-E393713 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E293391Length: 499 bp (845 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E293391 [] (trimmed) CCCCCGGCCTGCAGGGGCGTTGGAAGGATTACATAAAAGGCATTAAATCTGCATATACAAAAGAATTTTGCAGGTAAAGATCCTGTGAAGCGTCA
GATTGCAGTTGCAACTTATCTTATCGATAAATTAGCTCTGAGGGCAGGGAATGAGAAGGATGATGACGACGCTGATACAGTTGGTTGCTGTACTT
TGAAAGTAGAGAATGTAGAGCCAGTACCTCCAAATATTTTGAAGTTCGATTTTCTTGGTAAAGATTCTATCAGGTACCAAAATGAGGTGGCTGTG
TATGAGCCTGTTTTTAAAGCTATTCAACAGTTCCGAAGTGGAAAAAAGGGCAGTGACGATCTTTTTGACAAGCTTGATACGAGTAAGCTTAATGC
CCATCTAAAGGAACTCATGCCAGGGCTCACAGCAAAAGTATTTCGTACATATAATGCATCTTTTACATTGGAGCAGCAAGTAAGTTGCTTTCAGA
GACTAGACGTTTTTTTTGACTACT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E293391] SGN-U579225 Tomato 200607 Build 2 56 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T107216 [Download][View] Facility Assigned ID: TMECS65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0152 Quality Trim Threshold: 14.5