EST details — SGN-C806

Search information 
Request: 806Match: SGN-C806
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C806Clone name: cLEB-8-N3
cartOrder Clone
Library Name: cLEBOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: vegetative shoots including meristems and small expanidng leaves
Development Stage: 8 weeks

Microarray: This clone is not found on any microarray
This clone has been mapped as cLEB-8-N3.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E200469Length: 317 bp (760 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E200469 [] (trimmed) GACCAATGGAAGAGGATGCCCCTCAAGGGAAAAATGAGGAAGAGGAGTTCAATACTGGGCCACTTTCTGTCCTCATGATGAGTGTTAAGAATAAC
ACACAGGTGCTCATCAACTGTAGGAACAACAGGAAACTTCTTGGTCGTGTGAGAGCATTTGATCGTCACTGCAATATGGTGCTTGAAAATGTTAG
AGAAATGTGGACTGAGGTGCCCAAGACTGGAAAAGGAAAAAAGAAAGCTGTTGCTGTTAACAAAGATAGGTTTATCAGCAAGATGTTCCTTCGGG
GAGATTCTGTGATCATTGTCCTCCGAAATCCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E200469] SGN-U579030 Tomato 200607 Build 2 41 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T23220 [Download][View] Facility Assigned ID: TSHBE74TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0262 Quality Trim Threshold: 12.5