EST details — SGN-C80234

Search information 
Request: 80234Match: SGN-C80234
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C80234Clone name: cLET-11-K14
cartOrder Clone
Library Name: cLETOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4-6 weeks

Microarray: Alias clone SGN-C179693 is on microarray TOM1: SGN-S1-1-6.3.1.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179693 [TUS-32-G19] Trace: SGN-T185828 EST: SGN-E373165 Direction: 3' Facility: INRA
Clone: SGN-C179693 [TUS-32-G19] Trace: SGN-T185829 EST: SGN-E373166 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E292854Length: 526 bp (765 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E292854 [] (trimmed) TTGGTGCCAGACCGGTGATTGTGGTGGAGTCTTGGAATGCAAAGGATGGGGTAAACCACCAAACACCTTAGCTGAATACGCTTTGAATCAATTTA
GCAACTTAGATTTCTGGGACATTTCTGTTATTGATGGATTCAACATCCCTATGTCTTTCGGCCCAACTAACCCTGGGCCGGGAAAATGTCATCCA
ATTCAATGTGTTGCTAATATAAACGGTGAATGCCCTGGTTCACTTAGGGTACCCGGAGGATGTAACAACCCTTGTACTACATTCGGAGGACAACA
ATATTGTTGCACTCAAGGTCCATGTGGTCCTACCGATTTGTCAAGATTTTTCAAACAAAGATGTCCCGATGCCTATAGTTATCCTCAAGACGATC
CAACAAGTACTTTTACTTGTCAGAGTTGGACTACAGACTACAAGGTTATGTTTTGTCCTTATGGCTCTACTCACAATGAAACAACAAATTTCCCA
TTGGAGATTCCTACAAATACTCTTGAAGTGGCTTAATTAAGTAGAAATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E292854] SGN-U578836 Tomato 200607 Build 2 35 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T105317 [Download][View] Facility Assigned ID: TMEBP67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0048 Quality Trim Threshold: 14.5