Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C78894

Search information 
Request: 78894Match: SGN-C78894
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78894Clone name: cLES-7-B6
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185664 is on microarray TOM1: SGN-S1-1-3.4.9.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185664 [TUS-47-P14] Trace: SGN-T192513 EST: SGN-E391187 Direction: 3' Facility: INRA
Clone: SGN-C185664 [TUS-47-P14] Trace: SGN-T192514 EST: SGN-E391188 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E288035Length: 551 bp (844 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E288035 [] (trimmed) TAAAGAAAAATGGGGTTGTTCAACATCTGATTGTTACTCACTTGTCTCATGGTATTAGCCATATTTCACTCTTGTGAGGCCCAAAATTCACCCCA
AGACTATCTTGCGGTTCATAACGATGCCCGTGCCCAAGTCGGAGTCGGGCCTATGTCTTGGGATGCCAACTTGGCATCCCGAGCACAAAACTATG
CCAACTCAAGAGCTGGTGATTGTAACTTGATTCATTCTGGTGCTGGGGAGAATCTTGCCAAGGGTGGTGGTGACTTCACGGGGAGGGCAGCCGTG
CAATTGTGGGTGTCCGAGAGGCCAAGCTATAACTACGCTACCAACCAATGTGTTGGTGGAAAAAAGTGTAGACATTATACTCAAGTAGTCTGGCG
CAACTCAGTCCGACTAGGTTGTGGTCGGGCACGTTGCAACAACGGATGGTGGTTCATTTCTTGCAACTATGATCCTGTAAGCAACTGGATCGGAC
AACGTCCTTACTAAAATGATGTATACTTATGACATGTTGCTAGTATTAAATAAAATTCTCATATGAGACGGCGAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E288035] SGN-U579545 Tomato 200607 Build 2 213 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98791 [Download][View] Facility Assigned ID: TPSBB03THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0139 Quality Trim Threshold: 12.5