EST details — SGN-C78282

Search information 
Request: 78282Match: SGN-C78282
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C78282Clone name: cLES-5-C8
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185459 is on microarray TOM1: SGN-S1-1-8.4.10.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185459 [TUS-47-H1] Trace: SGN-T192335 EST: SGN-E391009 Direction: 5' Facility: INRA
Clone: SGN-C185459 [TUS-47-H1] Trace: SGN-T197768 EST: SGN-E396442 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E285600Length: 454 bp (778 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E285600 [] (trimmed) TCACCCAGGAACCAAATCGTAGTCCACATGACCTTCCTTGCCTGCAATAAATTCCACACAAGCAACACCATCCTCCTCTGCCTTGTGAGCAAGCA
TTGGCCCCGGAATGACATCACCAATTGCATATACCCCTGGGACATTACTGGCAAAACGTTCATTGACCAAGATCCTACCAGCCTTGTCAGTTTCA
ACACCTATCTTGTCCAGTCCAAGTCCTGAAGTGAAGGGAACCCTACCAGCAGAAACAAGAACAACATCAGCCTCAAGAGTAGTCTGCTCACCACC
CGCGGCAGGTTCAAGGGTCAACTTCACACTATCGCCAACAGTGTCAACTGACACCACCTTAGTTTTAAGCATGAACTTCATCTTTTGCTTCTCAA
GAGAACGTTGGAATTGCTTGCGAACTTCACCATCCATGGTTGGAACAATATCAGATGCAAATTCAACAACAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E285600] SGN-U578979 Tomato 200607 Build 2 39 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T98083 [Download][View] Facility Assigned ID: TPSAR16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0047 Quality Trim Threshold: 14.5