EST details — SGN-C77137

Search information 
Request: 77137Match: SGN-C77137
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C77137Clone name: cLES-20-B11
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C179234 is on microarray TOM1: SGN-S1-1-1.4.2.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C179234 [TUS-31-D16] Trace: SGN-T185632 EST: SGN-E373494 Direction: 3' Facility: INRA
Clone: SGN-C179234 [TUS-31-D16] Trace: SGN-T185633 EST: SGN-E373495 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E290398Length: 269 bp (1152 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E290398 [] (trimmed) TTGCTTGCTTGATCGGATTTGGCGCAAGTGCTGTATGTTCATACTTGGCATTTGAGACATGTCGACAATGGCGCTTGAGCACTAAAACTGTGAAT
TTGATGCGAAATGGGAAAATGCCTAGTGTTACCATTGAACAAGCTCAAAAAAACTTTTGCAAGGCAATTAAATCTGGGCTTCTCAAAATTCTTTC
AAAAATGGGGATCTCATTGCTCGCCAGTTATTGTGGTGCACAGATATTTGAAATCTATGGATTGGGGAAGGAGGTCATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E290398] SGN-U566807 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T102074 [Download][View] Facility Assigned ID: TPSDA06TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0181 Quality Trim Threshold: 14.5