EST details — SGN-C76541

Search information 
Request: 76541Match: SGN-C76541
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C76541Clone name: cLES-18-F20
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185564 is on microarray TOM1: SGN-S1-1-7.4.9.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185564 [TUS-47-L10] Trace: SGN-T192497 EST: SGN-E391171 Direction: 5' Facility: INRA
Clone: SGN-C185564 [TUS-47-L10] Trace: SGN-T192682 EST: SGN-E391356 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E289333Length: 439 bp (957 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E289333 [] (trimmed) GAACTTAATAAAATAGAACATACATTATTACGATCGGGTTGTAATATAACAAACCTCCAAAGTTCTATTACAAGATTTCAATTACGATACTAAAA
AAACACACAAAGAAGCTAAAGAGAGAAACAGACACAATCCGTGATTTAAGCAGGATCAATATCGACTTAATTATCTTATTCTTGTCCACATAATT
GTGCTACTACTATATATTATGATGTGGAAAACAAATCTCTTTCATTAACGTCACTTCACCTTGGAGCAGTCAACAGAGGGGCTGATCTCAAAAGG
AATCTTGACACCACAAACGGACAAAAGGGCATTTTTTTTTGGCTTTAGAAGAAGGAATTGAAATTCACCACAACAGATGAGAGTGATTCGAAGTA
GAGCAATACTGATAGTGCTTTTTCTGGTTTCTGCGTTTGGGTTAAGCGAACAGGGAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E289333] SGN-U584456 Tomato 200607 Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T101775 [Download][View] Facility Assigned ID: TPSCT34TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0070 Quality Trim Threshold: 14.5