EST details — SGN-C75380

Search information 
Request: 75380Match: SGN-C75380
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C75380Clone name: cLES-13-N18
cartOrder Clone
Library Name: cLESOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185231 is on microarray TOM1: SGN-S1-1-4.2.12.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185231 [TUS-46-N13] Trace: SGN-T199059 EST: SGN-E397733 Direction: 5' Facility: INRA
Clone: SGN-C185231 [TUS-46-N13] Trace: SGN-T200112 EST: SGN-E398786 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E286168Length: 493 bp (775 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E286168 [] (trimmed) CTTTTCTATTTCCCCTCTCTCTCTCTCTAGATTTTTTTCTCTCTCTCTCTAAAACTTCCAAATTCTATCCAAAGAGAAAAAAAAAAAATAAAAAA
AAAATCATGTCTACAGATCTACAATTTCCACAAGATCTCTTTGAAATGAATTCACCAAATATCAATTCTTCTCAAAGATGTATCAACAGCAATAT
TAATATTATTATCAGTAATAAAGATGATTGCAAAACCCCAAAATCTTCACCTTTTTTAATCCCAAAAATCCTCAAATGCCCAGCTGCACCTAAAA
AACCCAGAAGGGTAATTTCGTCCTGTAAGAGAAAATTACAATTTGTTGAAATTGTTGCTAGTAAAGAAGTTGAATCATTTTTCAAAATCCTCGAT
GATGATGTCGTTGCTTCGTCTTCGAAAAAGATATGAGGTGCTCGAAAATAATCAAATCAAATCGATTCATTCGAGTGTACGAGAATGATTAAAGT
TAGTTCTATTTGAAGATC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E286168] SGN-U570658 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T100481 [Download][View] Facility Assigned ID: TPSBZ81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.900 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5