EST details — SGN-C75364
| Search information |
| Request: 75364 | Match: SGN-C75364 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C75364 | Clone name: cLES-13-M21 |
| ||
| Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C185528 is on microarray TOM1: SGN-S1-1-3.2.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C185528 [TUS-47-J22] | Trace: SGN-T192493 | EST: SGN-E391167 | Direction: 5' | Facility: INRA |
| Sequence |
| Sequence Id: SGN-E285916 | Length: 149 bp (243 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E285916 [] (trimmed)
TGAGAAAATCAAACCGTAGAATCGAACAATGAGTCGAGGAAGTGGAGGCGGATACGATCGTCACATTACGATCTTCTCACCGGAAGGTCGTCTCT
TTCAAGTCGAATATGCTTTTAAGGCTGTGAAGGCAGCTGGAATCACATCTATTG
TTCAAGTCGAATATGCTTTTAAGGCTGTGAAGGCAGCTGGAATCACATCTATTG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E285916] | SGN-U565096 | Tomato 200607 | Build 2 | 50 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T100229 [Download][View] | Facility Assigned ID: TPSBW83TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.919 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 14.5 |
Working
