EST details — SGN-C75364
Search information |
Request: 75364 | Match: SGN-C75364 |
Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
Clone information |
SGN ID: SGN-C75364 | Clone name: cLES-13-M21 |
| ||
Library Name: cLES | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C185528 is on microarray TOM1: SGN-S1-1-3.2.9.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C185528 [TUS-47-J22] | Trace: SGN-T192493 | EST: SGN-E391167 | Direction: 5' | Facility: INRA |
Sequence |
Sequence Id: SGN-E285916 | Length: 149 bp (243 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E285916 [] (trimmed)
TGAGAAAATCAAACCGTAGAATCGAACAATGAGTCGAGGAAGTGGAGGCGGATACGATCGTCACATTACGATCTTCTCACCGGAAGGTCGTCTCT
TTCAAGTCGAATATGCTTTTAAGGCTGTGAAGGCAGCTGGAATCACATCTATTG
TTCAAGTCGAATATGCTTTTAAGGCTGTGAAGGCAGCTGGAATCACATCTATTG
Unigenes |
Current Unigene builds | |||||
[SGN-E285916] | SGN-U565096 | Tomato 200607 | Build 2 | 50 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T100229 [Download][View] | Facility Assigned ID: TPSBW83TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.919 | Expected Error Rate: 0.0001 | Quality Trim Threshold: 14.5 |