EST details — SGN-C74034
| Search information |
| Request: 74034 | Match: SGN-C74034 |
| Request From: SGN database generated link | Match Type: cDNA clone internal identifier |
| Clone information |
| SGN ID: SGN-C74034 | Clone name: cLER-7-I14 |
| ||
| Library Name: cLER | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: leaf
Development Stage: 4 weeks
Microarray: Alias clone SGN-C185964 is on microarray TOM1: SGN-S1-1-7.1.7.7
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
No additional reads found.[Show information hierarchy]
| Sequence |
| Sequence Id: SGN-E280987 | Length: 125 bp (1523 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E280987 [] (trimmed)
CAAAAAAAGACCAGAAGATTCCAAAACTTGCCCATATTTCCACCAGCTGGAAGCACTGTACAAAGAAAAAGCCAAGCTCGAACCTGTACCACACA
ACACTACCTTCGGATTAACACCCCAAAACA
ACACTACCTTCGGATTAACACCCCAAAACA
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E280987] | SGN-U575103 | Tomato 200607 | Build 2 | 7 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T93450 [Download][View] | Facility Assigned ID: TPRAZ55TH |
| Submitter: Koni | Sequencing Facility: TIGR |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.920 | Expected Error Rate: 0.0451 | Quality Trim Threshold: 14.5 |


