EST details — SGN-C74034

Search information 
Request: 74034Match: SGN-C74034
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C74034Clone name: cLER-7-I14
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185964 is on microarray TOM1: SGN-S1-1-7.1.7.7
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280987Length: 125 bp (1523 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E280987 [] (trimmed) CAAAAAAAGACCAGAAGATTCCAAAACTTGCCCATATTTCCACCAGCTGGAAGCACTGTACAAAGAAAAAGCCAAGCTCGAACCTGTACCACACA
ACACTACCTTCGGATTAACACCCCAAAACA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280987] SGN-U575103 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93450 [Download][View] Facility Assigned ID: TPRAZ55TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.920 Expected Error Rate: 0.0451 Quality Trim Threshold: 14.5