EST details — SGN-C73931

Search information 
Request: 73931Match: SGN-C73931
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C73931Clone name: cLER-7-C16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C183578 is on microarray TOM1: SGN-S1-1-1.1.1.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183578 [TUS-42-I16] Trace: SGN-T196034 EST: SGN-E394708 Direction: 3' Facility: INRA
Clone: SGN-C183578 [TUS-42-I16] Trace: SGN-T196035 EST: SGN-E394709 Direction: 5' Facility: INRA
Clone: SGN-C183578 [TUS-42-I16] Trace: SGN-T200458 EST: SGN-E399578 Direction: 5' Facility: INRA
Clone: SGN-C183578 [TUS-42-I16] Trace: SGN-T200308 EST: SGN-E399279 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280977Length: 238 bp (1543 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280977 [] (trimmed) TTTACTTTGCTCTAAAAGATATTAAATTTGTTTATATTTAAGCATTATGGTGTCTCTAAATAGGAACCTCATTTTGGCATTTTTGTGTGTTTTAT
TGTGCTTTGTTGTTAGCTTTAGCAATGCCCAATTATCAGCCAATTTTTATGGGACGTCGTGCCCTAATCTGCAGACAATTGTAAGAAATGCAATG
ACACAAGCTGTGAATAGAGAGGCCAGACTTGGTGCCTCTATTCTTCGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280977] SGN-U566251 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T93440 [Download][View] Facility Assigned ID: TPRAZ20TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0354 Quality Trim Threshold: 14.5