EST details — SGN-C73465

Search information 
Request: 73465Match: SGN-C73465
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C73465Clone name: cLER-4-O7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C185322 is on microarray TOM1: SGN-S1-1-1.2.10.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185322 [TUS-47-B8] Trace: SGN-T192453 EST: SGN-E391127 Direction: 5' Facility: INRA
Clone: SGN-C185322 [TUS-47-B8] Trace: SGN-T192647 EST: SGN-E391321 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E278074Length: 448 bp (910 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E278074 [] (trimmed) TAGAAAAAAGCAAATGCAAAGCTTAGTAGTGAAAGCAAATAATGGTGAAAGGCGTACCTTTTTGACACTAGAAGAAGCTGGCCTTGTTGAAGTGT
CCGGCCTCAGCACTCATGAACGTTTTCTATGTCGATTGACGATTTCATCTCTCAATTTATTAAAAGTGATAGGAGAACAAGAAGGTTGTTCAATT
GAAGAGTTAAATGCTGGGAAAATATGTGATTGGTTCTTGAAAGATAAGCTTAAAAGAGAACAAAATTTGGATTCTGCTGTACTTCAATGGGATGA
ATCTGATTTCCAACTATAATTCTCCCTCTATTGAAAGTAATTATTTAAAAATATAAAAATGAACAAAACACTAATTCTTTTCCCTTAATAATACT
CCTTGCTTCCTTTTTTATGTAGTAACGCTTATTTATTTTCAATGTCTGAATCTTATATGCTATGTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E278074] SGN-U580380 Tomato 200607 Build 2 55 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92907 [Download][View] Facility Assigned ID: TPRAM88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.921 Expected Error Rate: 0.0039 Quality Trim Threshold: 14.5