EST details — SGN-C72234

Search information 
Request: 72234Match: SGN-C72234
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72234Clone name: cLER-1-J11
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178581 is on microarray TOM1: SGN-S1-1-6.1.4.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178581 [TUS-29-I11] Trace: SGN-T183844 EST: SGN-E370503 Direction: 3' Facility: INRA
Clone: SGN-C178581 [TUS-29-I11] Trace: SGN-T183845 EST: SGN-E370504 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280399Length: 281 bp (719 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280399 [] (trimmed) ATCATGACCCAACATAATACACAATTACATATCCATTTATGCGTAATCAACCGATAATTTCGATTAATTACAAACTTAGTAGGGAAACAAAAAGA
ATTAACAAGTGCGTAAGGGGGATCCACACAAACAATCATTTTTAGAGAAAGAAGAAGCTTTTAAATGATCGAAGGGGGACCCGTTTGGAATCGAG
CCACAAAGGGGATTATGGTTTAAATCCAAAGGACCAATGAACTTAGCTGATGATAATGATTTTGGAATTGAACCTCGAAGATTATTGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280399] SGN-U577694 Tomato 200607 Build 2 53 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91953 [Download][View] Facility Assigned ID: TPRAC54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.851 Expected Error Rate: 0.0206 Quality Trim Threshold: 14.5