Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C72163

Search information 
Request: 72163Match: SGN-C72163
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72163Clone name: cLER-1-F5
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178525 is on microarray TOM1: SGN-S1-1-6.3.4.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280593Length: 390 bp (733 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E280593 [] (trimmed) GGAATAGAAAAATCCATTATATTGTCAACTCATTCACAACAACTTTACATGAAAATTTGAAAATCATTTTATGATATTCACTTTCCGGGAACAAA
GTTTGTGGCGAAGGCCCAGGCGTTGTTGTTTACTGGGTCTGCAAGGTGATCAGCAAGGTTCTCCAATGGACCTTTTCCGGTAACAATGGCTTGAA
CAAAGAATCCAAACATAGAGAACATAGCAAGTCTACCGTTCTTGATCTCCTTTACCTTGAGCTCAGCAAATGCCTCGGGGTCTTCAGCAAGGCCT
AATGGGTCGAAGCTTCCACCGGGGTAGAGTGGGTCGACAACCTCACCAAGAGGTCCACCAGCAATACGGTAACCTTCAACAGCTCCCATCAACAC
AACTTGGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280593] SGN-U578708 Tomato 200607 Build 2 218 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T92147 [Download][View] Facility Assigned ID: TPRAC27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0131 Quality Trim Threshold: 14.5