EST details — SGN-C72052

Search information 
Request: 72052Match: SGN-C72052
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C72052Clone name: cLER-1-A16
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C178424 is on microarray TOM1: SGN-S1-1-3.2.4.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178424 [TUS-29-B22] Trace: SGN-T184176 EST: SGN-E371409 Direction: 3' Facility: INRA
Clone: SGN-C178424 [TUS-29-B22] Trace: SGN-T184177 EST: SGN-E371410 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E280347Length: 516 bp (824 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E280347 [] (trimmed) TTTCTCTGCCACCAAAGGTGATTTCACTGACGGCCGCCACCAATCTGAGAAAATGTCGCAAGAATCACTAGTCCTCCGCGGTACCATGAAAGCCC
ACACTGACTGGGTCACTGCTATTGCAACCCCAATTGACAACTCCGACATGATTGTCACCTCCTCCAGGGATAAGTCCATCATCGTCTGGTCTTTG
ACTAAAGACGGCTCACAATACGGTGTCCCTCGTCGCCGTCTTACCGGACATGGCCATTTCGTTGAAGATGTCGTGTTGTCGTCTGACGGCATGTT
TGCACTCTCCGGTTCATGGGACGGTGAGCTCCGTTTATGGGATCTTCAAGCTGGAACAACTGCTCGTCGTTTCGTTGGACACACTAAAGATGTTC
TCTCTGTTGCATTCTCTGTTGACAACCGTCAGATTGTCTCTGCTTCCCGTGACAAGACCATCAAGCTATGGAACACACTCGGTGAGTGCAAGTAC
ACAATTCAGGAACAGGAATTACACTCTGATTGGGGTTCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E280347] SGN-U582594 Tomato 200607 Build 2 106 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T91901 [Download][View] Facility Assigned ID: TPRAB08TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.970 Expected Error Rate: 0.0081 Quality Trim Threshold: 14.5