Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C70952

Search information 
Request: 70952Match: SGN-C70952
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C70952Clone name: cLER-16-G7
cartOrder Clone
Library Name: cLEROrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: leaf
Development Stage: 4 weeks

Microarray: Alias clone SGN-C182454 is on microarray TOM1: SGN-S1-1-5.2.7.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182454 [TUS-39-J20] Trace: SGN-T191547 EST: SGN-E390221 Direction: 5' Facility: INRA
Clone: SGN-C182454 [TUS-39-J20] Trace: SGN-T197574 EST: SGN-E396248 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E284354Length: 536 bp (763 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E284354 [] (trimmed) TTGAAGACAGGAATGGTGAGCAGACATCCAATTTCTACAAGAAATCTTGATTTTGGAGTCATCAATCCAGCTTATGTTGGAAAAAAGAACAAGTA
CGTATATGCAGCCATTGGGGGTCCTATGCCAAAAGTAATAGGGATAGCAAAATTAGACGTATCCGTAGCAGAAATTGATCGTCGCGATTGCATCG
TGGCATGTCGTATATTTGGAAAAGATTGCTATGGTGGTGAACCATTTTTCGTGCCTAAAAATCCTTCGATTGATGAAGACGATGGCTACGTGGTG
TCATACGTACACAATGAGAAGACAGGGGAATCAAATTTTTTGGTCATGGATGCAACATCACCTAATCTTGACATTGTGGCTAATGTCAAATTGCC
TCGTCGTGTGCCTTACGGTTTCCATGGACTTTTCGTGAGTGAAAATGATCTTATGAAGCTATAAATATCGATATATTGATTAAATTATTTAAGAA
CTATGTATAATATGTATGTATATAAATGATATATAGGTTGATTCCTCTTTAAAATAGTATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E284354] SGN-U570287 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T95627 [Download][View] Facility Assigned ID: TPRCI40THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.958 Expected Error Rate: 0.0035 Quality Trim Threshold: 14.5