EST details — SGN-C6965

Search information 
Request: 6965Match: SGN-C6965
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6965Clone name: cLEC-37-G17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C174091 is on microarray TOM1: SGN-S1-1-8.2.17.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208326Length: 406 bp (876 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208326 [] (trimmed) CCCAGATTAACAAATGGGGTAACGGTAAGATCTCGTATAAGCTTCTTTACAATACCCTTTTGGAGTATGAGAATCTCATTGGGTTCTGGCGCCGG
AGTGGTGCTGAATCTGATTCACCGTTGATCTTTTTTGAGTGGGGTCCGTTTCATATAGCTGGTTCGAGGGTGAAACCCTCGAGAAATGGTACTTA
TGAAGTGATAAAGTTGCCATTTTTATGGATGGGTATTACCTCTAAGGGTGAAATTGTTAATTATCTTGACCCTGTGGGGAAGGTGGAGTTATCGG
GAAATGTGATGAATTTAGATGATTTGGGTGTTGTGGAGAGTGAATTGGTTCCAGTGAATGTGAATTTCGTGGGAAGAACTCATGTTGTTGTGGAA
GAAAATGGTACTGCATTTGGGTACTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208326] SGN-U583424 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31317 [Download][View] Facility Assigned ID: TCAFO45TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.945 Expected Error Rate: 0.0082 Quality Trim Threshold: 14.5