EST details — SGN-E693238

Search information 
Request: 693238Match: SGN-E693238
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C470244Clone name: LH_Ea10M20
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C470244 [LH_Ea10M20] Trace: SGN-T490797 EST: SGN-E697078 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E693238Length: 374 bp (1121 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E693238 [] (trimmed) TTTTTACTGAGAAACTAGAGGCAGCATGCATTGGTGCACTGGAATCTGGAAAGATGACGAAAGATCTTGCACTCATCATCCATGGATCCAAGCTT
TCACGAGAGCATTATCTGAACACGGAAGAGTTCATTGACGCTGTAGCTGATGAGCTCAAAGCAAAACTTCTGAAAGCAAAGGCCTAAATGTATGA
GCGAGGACGAGTCAGTTTGAGGCTATTGAATTGAAGAGAAATAAAAGGAGTTAAGGCCTTGTTTGGTATACTAAATTTCAAGAGGTTTTTATCTT
TTTAGGTTGAGGATTATTCTCCAGACACTACATTTTGAACCATTTGAATCTGAATTTCTATTGCTGAAAAAAAAAAAAGAAAAAAAAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E693238] SGN-U574588 Tomato 200607 Build 2 44 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T494179 [Download][View] Facility Assigned ID: LH_Ea10M20.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.930 Expected Error Rate: 0.0020 Quality Trim Threshold: 12.5