EST details — SGN-C6920

Search information 
Request: 6920Match: SGN-C6920
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6920Clone name: cLEC-37-E15
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183838 is on microarray TOM1: SGN-S1-1-5.4.19.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183838 [TUS-43-D12] Trace: SGN-T198094 EST: SGN-E396768 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E208320Length: 429 bp (864 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E208320 [] (trimmed) TTGTACTAAATTCGCTTCGATATAAAAATTCATAACCAAAATTCAAAATGTATTCAAATTGTGAACTAGAAAATGATTTTTCAGTACTCGAATCA
ATTAGAAGATACTTACTTGAAGATTGGGAAGCTCCATTAACGAGCTCTGAAAACTCAACATCCTCAGAGTTCAGCCGGAGCAACAGCATTGAATC
CAATATGTTTAGTAATTCATTTGATTATACACCTGAAATTTTTCAAAATGATATTCTTAATGAAGGATTTGGATTTGGATTTGAATTCGAGACTT
CTGATTTTATAATCCCTAAATTAGAGTCACAAATGTCAATCGAATCACCTGAAATGTGGAATTTACCGGAATTTGTGGCTCCATTAGAGACGGCG
GCGGAGGTGAAAGTTGAAACACCGGTTGAGATGACAACTACGACGACGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E208320] SGN-U569393 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T31311 [Download][View] Facility Assigned ID: TCAFO32TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5