Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E691473

Search information 
Request: 691473Match: SGN-E691473
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C468479Clone name: LH_Ea06D07
nocartOrdering Not Available
Library Name: LH_EaOrganism: Solanum habrochaites (formerly Lycopersicon hirsutum)

Tissue: Glandular Trichomes
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C468479 [LH_Ea06D07] Trace: SGN-T492132 EST: SGN-E695313 Direction: 3' Facility: AGI
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E691473Length: 340 bp (1182 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E691473 [] (trimmed) CCGGTAAAGAATGGGTTCCAAAGCATTTCTGGTTTTTGGTCTCCTTTTGGCTATTTTCCTAATGATAAGCTCTGAGATTTTAGCTACTGAGTTGG
CTGAGACTTCTAAGAAATCTGATAACAAGAATGAAGTACATGAAGCCCAATATGGTGGATATGGACGCGGTGGTGGTGGATATGGACGCGGTGGT
GGTGGAGGATATGGACGTGGTGGTGGATACGGACATGGTGGTGGTGGTGGATATGGACATGGTGGTGGTGGATATGGATACGGTGGTGGATACGG
ACACCGTGGTGGCGGTGGTGGTGGACGACGTGGAGGATACTGCCAGCATGGTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E691473] SGN-U577417 Tomato 200607 Build 2 166 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T496402 [Download][View] Facility Assigned ID: LH_Ea06D07.f
Submitter: Eyal Fridman Sequencing Facility: AGI
Funding Organization: NSF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0109 Quality Trim Threshold: 14.5