EST details — SGN-E648619

Search information 
Request: 648619Match: SGN-E648619
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C445492Clone name: cccs30w23k1
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C445492 [cccs30w23k1] Trace: SGN-T472122 EST: SGN-E648403 Direction: 5' Facility: Cornell
Clone: SGN-C445492 [cccs30w23k1] Trace: SGN-T469355 EST: SGN-E645636 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E648619Length: 62 bp (1027 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E648619 [] (trimmed) TTTTGGTAATTGCTTCAGCCACGGCCCACCAAACTACCATAACCACCACTGAGCTGGAGGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E648619] SGN-U617461 Coffea canephora Build 3 1378 ESTs assembled
[SGN-E648619] SGN-U637624 Coffee species Build 1 1678 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T472338 [Download][View] Facility Assigned ID: cccs30w23k1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15