Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E646834

Search information 
Request: 646834Match: SGN-E646834
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C443688Clone name: cccs30w23i10
nocartOrdering Not Available
Library Name: cccs30wOrganism: Coffea canephora

Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C443688 [cccs30w23i10] Trace: SGN-T471774 EST: SGN-E648055 Direction: 5' Facility: Cornell
Clone: SGN-C443688 [cccs30w23i10] Trace: SGN-T467551 EST: SGN-E643832 Direction: 5' Facility: Cornell
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E646834Length: 353 bp (1035 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E646834 [] (trimmed) GGATACTTTGAGGACATCAAAGACGCTGTGGAAAGAGAGTGCCCTGGAGTTGTTTCCTGTGCTGATATACTGGTGTTGTCTGCCACAGATGGCAT
CGTTGCTTTGGGAGGACCTTATATTCCACTTAAAACTGGAAGAAGGGATGGCATAAGGAGCATACCTGAGATTCTTGAGCAGCATCTCCCGGATC
ACAATGAGAGCATGACTGTTGTCCTTGACCGATTTGGATCTATTGGTATTGATGCCCCTGGAGTTGTTGCCTTGTTACGTGCTCACAGTGTGGGC
AGAACCCGCTGTGTGAAGCTGGTTCACCGTCTATACCCATAGGTTGATCCAGCATTCCCAGCTTCCCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E646834] SGN-U617469 Coffea canephora Build 3 213 ESTs assembled
[SGN-E646834] SGN-U637635 Coffee species Build 1 289 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T470553 [Download][View] Facility Assigned ID: cccs30w23i10_1.i
Submitter: None Sequencing Facility: Cornell
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.000 Expected Error Rate: 0.0000 Quality Trim Threshold: 15