Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-C64600

Search information 
Request: 64600Match: SGN-C64600
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64600Clone name: cLEM-6-J9
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178134 is on microarray TOM1: SGN-S1-1-5.2.4.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178134 [TUS-28-F20] Trace: SGN-T183640 EST: SGN-E370708 Direction: 3' Facility: INRA
Clone: SGN-C178134 [TUS-28-F20] Trace: SGN-T183641 EST: SGN-E370709 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270893Length: 432 bp (988 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270893 [] (trimmed) GTTCTCTTCAAGGTTTCTCTATTAGTCTCTCTGAAAAAAAATGGCCGACGTGGAATACAGGTGCTTCGTCGGTGGTCTGGCATGGGCCACCACCG
ACCAAACACTTTCGGAAGCTTTTTCTCAGTACGGCGAAGTGGTCGAATCCAAGATCATCAATGACCGGGAAACTGGTAGATCTAGAGGATTTGGA
TTCGTTACCTTCAAGGATGAGCAAGCCATGAGGGATGCTATTGAAGGGATGAACGGCCAGGATCTTGATGGTCGCAACATCACCGTGAACGAAGC
TCAATCACGCGGAGGCGGTGGAGGTGGAGGTGGAAGAAGCGGGGGTGGTTACAGAGGTGGCCGACGTGAAGGCGGTGGCGGAGGCTACGGTGGTG
GCGGCGGCTACAGAAGTGGCCGACGTGAAAGCGGCAGCGGCGGCTACTGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270893] SGN-U580606 Tomato 200607 Build 2 128 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84649 [Download][View] Facility Assigned ID: TGFAW53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.980 Expected Error Rate: 0.0176 Quality Trim Threshold: 14.5