EST details — SGN-C64448

Search information 
Request: 64448Match: SGN-C64448
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64448Clone name: cLEM-6-C7
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C178035 is on microarray TOM1: SGN-S1-1-8.2.4.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C178035 [TUS-28-B17] Trace: SGN-T183538 EST: SGN-E371178 Direction: 3' Facility: INRA
Clone: SGN-C178035 [TUS-28-B17] Trace: SGN-T183539 EST: SGN-E371179 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E270618Length: 261 bp (995 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E270618 [] (trimmed) ACTCCGTCGGAAAATCCTGATCAGATCCGCCATCTTTTTTTTAAGTTACTGGATACAGGAACTCGTACCGAAAGATCCAATTAAATGGCTCCGGT
TTCGGCTCTCGCAAAGTACAAGCTCGTTTTCTTAGGAGAACAATCTGTCGGCAAGACCAGTATTATCACGCGATTCATGTATGATAAATTCGATA
ACACCTATCAAGCCACAATTGGTATTGACTTCCTATCAAAGACTATGTACCTGGAAGATCGTACAGAAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E270618] SGN-U591093 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84374 [Download][View] Facility Assigned ID: TGFAU16TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0320 Quality Trim Threshold: 20.5