EST details — SGN-E643832
Search information |
Request: 643832 | Match: SGN-E643832 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C443688 | Clone name: cccs30w23i10 |
| ||
Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C443688 [cccs30w23i10] | Trace: SGN-T470553 | EST: SGN-E646834 | Direction: 5' | Facility: Cornell |
Clone: SGN-C443688 [cccs30w23i10] | Trace: SGN-T471774 | EST: SGN-E648055 | Direction: 5' | Facility: Cornell |
Sequence |
Sequence Id: SGN-E643832 | Length: 82 bp (1020 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E643832 [] (trimmed)
CTCCCGGATCACAATGAGAGCATGACTGTTGTCCTTGACCGATTTGGATCTATTGGTATTGATGCCCCTGGAGTTGTTGCCT
Unigenes |
Current Unigene builds | |||||
[SGN-E643832] | SGN-U617469 | Coffea canephora | Build 3 | 213 ESTs assembled | |
[SGN-E643832] | SGN-U637635 | Coffee species | Build 1 | 289 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T467551 [Download][View] | Facility Assigned ID: cccs30w23i10.i |
Submitter: None | Sequencing Facility: Cornell |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |