EST details — SGN-E643304
| Search information |
| Request: 643304 | Match: SGN-E643304 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C443160 | Clone name: cccs30w23h21 |
| ||
| Library Name: cccs30w | Organism: Coffea canephora |
Tissue: Endosperm and perisperm
Development Stage: 30 week after pollination
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C443160 [cccs30w23h21] | Trace: SGN-T469636 | EST: SGN-E645917 | Direction: 5' | Facility: Cornell |
| Clone: SGN-C443160 [cccs30w23h21] | Trace: SGN-T468201 | EST: SGN-E644482 | Direction: 5' | Facility: Cornell |
| Sequence |
| Sequence Id: SGN-E643304 | Length: 205 bp (1118 bp untrimmed) |
| Status: Current Version | Direction: 5' |
>SGN-E643304 [] (trimmed)
ATTTTGCTGGTGGCCCTTTTGGCTATTGCATAAGACGCGGCCCACCGAACTACCATAACCACCACTGTGCTGGAGGATGAGGAGGACCCAGGACA
AGGAGGGCAGTCGCACAGATGCCAGCAGAAAATCCAAGAGCAGCAGCAGCAGCTCTGGCACTGCCAGCAATACTTGTCTCAGATGAACCCTTCTG
ACTTGCGCATGTACC
AGGAGGGCAGTCGCACAGATGCCAGCAGAAAATCCAAGAGCAGCAGCAGCAGCTCTGGCACTGCCAGCAATACTTGTCTCAGATGAACCCTTCTG
ACTTGCGCATGTACC
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E643304] | SGN-U617461 | Coffea canephora | Build 3 | 1378 ESTs assembled | |
| [SGN-E643304] | SGN-U637624 | Coffee species | Build 1 | 1678 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T467023 [Download][View] | Facility Assigned ID: cccs30w23h21_1.i |
| Submitter: None | Sequencing Facility: Cornell |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.000 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 15 |
Working
