EST details — SGN-C64267

Search information 
Request: 64267Match: SGN-C64267
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C64267Clone name: cLEM-5-K13
cartOrder Clone
Library Name: cLEMOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit
Development Stage: immature green fruit

Microarray: Alias clone SGN-C177929 is on microarray TOM1: SGN-S1-1-2.2.6.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177929 [TUS-27-N7] Trace: SGN-T183183 EST: SGN-E370946 Direction: 3' Facility: INRA
Clone: SGN-C177929 [TUS-27-N7] Trace: SGN-T183184 EST: SGN-E370947 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E271192Length: 457 bp (1028 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E271192 [] (trimmed) CGAGGATTTTCCTCCATCATCGAGAAGAGACAAAGGAAAAAAAAACCCTAAGACGAGATGATGCTTCGAGTAGCAGGTAGAAGAGCTTTCTTCTT
CAGCCGCTAGATCTTCATCTAGCTTCTTTACAAGAAGCTCTTTCACCGTTACCGATGATTCGTCTCCGGCCAGATCTCCTTCTCCGTCACTCACC
TCTTCGTTTCTCGATCAAATCAGAGGTTTCTCATCTAATTCGGTTTCTCCCGCACATCAGTTGGGTTTAGTCTCGGATCTTCCAGCCACTGTGGC
TGCGATTAAGAACCCCAGTTCAAAAATTGTATATGATGACTCCAACCATGAGCGTTATCCACCTGGTGATCCAAGCAAACGTGCTTTTGCTTACT
TTGTCTTGACAGGAGGTAGGTTCGTCTATGCCTCATTGCTTCGCCTCCTGATTCTCAAGTTTGTTCTGAGCATGTCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E271192] SGN-U581313 Tomato 200607 Build 2 150 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T84997 [Download][View] Facility Assigned ID: TGFAQ67TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0163 Quality Trim Threshold: 14.5