EST details — SGN-C6301

Search information 
Request: 6301Match: SGN-C6301
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C6301Clone name: cLEC-35-A17
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C173877 is on microarray TOM1: SGN-S1-1-6.1.17.3
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C173877 [TUS-17-E11] Trace: SGN-T191424 EST: SGN-E390098 Direction: 5' Facility: INRA
Clone: SGN-C173877 [TUS-17-E11] Trace: SGN-T197499 EST: SGN-E396173 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E210413Length: 442 bp (1746 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E210413 [] (trimmed) CGGAATCGGAGGCAGATATCAGCGATGGCCACCGCCGGTAAACTCGTGTCGTCGTCGTCGTCGTCACCCAAGCCTTTCGATTTCTCCGACGATTC
AGTTCCTAAGAGAGTCGTTCTGTCGAGTGATCAGCAGCGTTATTGCTTGGAAGTACTCAAAGTCTTCAAGGACAAGAGGTTTTCTGCTCCCGAAA
AAATCCGCCAAGAGTTCATGACGTTGCAGGCAACTAGGATGAGAGCTTCAGAAATGAAAAGTAGATGCTCAATGGCTTTGAACAGCGCAAACATT
AGCAAAAATCGATACACTGATGTTCTGCCATTTGACAATAACAGGGTTGTTTTGGACCCACCAGCTAGAGGATATATAAATGCAAGCTTCATTAA
GATATCTGAAGACGTGTCTCAGTTTATTGCAACACAAGGTCCTCTACAACACACTTTTGAAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E210413] SGN-U581407 Tomato 200607 Build 2 33 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30761 [Download][View] Facility Assigned ID: TCAFG09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5