EST details — SGN-C5806

Search information 
Request: 5806Match: SGN-C5806
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C5806Clone name: cLEC-33-C20
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C184035 is on microarray TOM1: SGN-S1-1-8.4.18.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C184035 [TUS-43-L17] Trace: SGN-T198053 EST: SGN-E396727 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E206957Length: 459 bp (786 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E206957 [] (trimmed) GTTATTTGGAAAATGATGGTAAACAACAGCCTCCATATATTTGTACAGCCCCAATAAAGTATAACTTTGCAAATTTCTCCAATCCGGATTATGCA
AAAACGGGAAACACTTCTCTCAAGTTCCAGTTAATCAATCAGCGGGCAGATTTCTCCTTTGCATTGTTTACAGGCGGGTTGTCAAATCCAAAGCT
GGTAGGTGTTTCAAATTACATATCATTTGCAAATCCTAAAGCACCACTTTATCCACGGCTTGCTTTGGGGAAATCATGGAATGAAATGACATTGA
CCTGGACAAGCGGCTATAATTTACTTGAAGCTGTTCCTTTCATTGAATGGGGTCGGAAGGGTGATCCCCAACATCGCTCACCAGCAGGAACATTG
ACATTTGATAGAAATACAATGTGTGGTTCACCTGCTCGAACAGTTGGCTGGCGTGATCCAGGGTTCATACATACTAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E206957] SGN-U586187 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T30229 [Download][View] Facility Assigned ID: TCAEZ22TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0090 Quality Trim Threshold: 14.5