Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E548964

Search information 
Request: 548964Match: SGN-E548964
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C192605Clone name: TUS-66-A19
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C93730 [cLEX-15-I7] Trace: SGN-T117879 EST: SGN-E305393 Direction: 5' Facility: TIGR
Clone: SGN-C192605 [TUS-66-A19] Trace: SGN-T344836 EST: SGN-E543961 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E548964Length: 201 bp (890 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E548964 [] (trimmed) GATACCGCCCTCCATTTATGCATTGGTTTCAAAAAACGATTATTTACATTTTTGTTGCATTTTGAAATTTTTTCATTTTTCTTCAGCAAATAACT
TTTTTACTTCTTGGCGGGGGCCTTAGCAAAAGGCTTGGCACCAAAAGGAGGGAAAACCTTGACACCAACCTTGCCCTTCTTCTCAGGGGAAGCCA
AAACACCCTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E548964] SGN-U598762 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T349839 [Download][View] Facility Assigned ID: TUS66A19_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.946 Expected Error Rate: 0.0388 Quality Trim Threshold: 14.5