EST details — SGN-E548123
| Search information |
| Request: 548123 | Match: SGN-E548123 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C189630 | Clone name: TUS-58-E20 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C72755 [cLER-2-B4] | Trace: SGN-T92709 | EST: SGN-E278991 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C189630 [TUS-58-E20] | Trace: SGN-T339722 | EST: SGN-E538847 | Direction: 5' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E548123 | Length: 205 bp (891 bp untrimmed) |
| Status: Current Version | Direction: 3' [See links to 5' reads above] |
>SGN-E548123 [] (trimmed)
TCCTTTTTTTTTCTGCCCACCCATGAATGAATACCCAATTTTCTTCCTACCTATGTCCATAAAAGAATTTAAACTTCCCATATACTACACCTCAC
ATATAAATATATACCCTGCCCGACCCTTCCCTAGTTGAATCCCAACCAACCATACAACTTAACTTGAGGGGTTTTTCTTTCCTTTCCAATACACA
AATTAAATTATCTTT
ATATAAATATATACCCTGCCCGACCCTTCCCTAGTTGAATCCCAACCAACCATACAACTTAACTTGAGGGGTTTTTCTTTCCTTTCCAATACACA
AATTAAATTATCTTT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E548123] | SGN-U602559 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T348998 [Download][View] | Facility Assigned ID: TUS58E20_P1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.965 | Expected Error Rate: 0.0431 | Quality Trim Threshold: 12.5 |


