EST details — SGN-E547460
| Search information |
| Request: 547460 | Match: SGN-E547460 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C194642 | Clone name: TUS-71-F16 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C104272 [cLPP-13-H8] | Trace: SGN-T173418 | EST: SGN-E361015 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C194642 [TUS-71-F16] | Trace: SGN-T348334 | EST: SGN-E547459 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E547460 | Length: 207 bp (908 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E547460 [] (trimmed)
AGGATGTGGGAAAAGCTTTTAAAGAGGCATGTGCATCAACAAGTCCAAGTACGATCGTGATCCCAAAAGGAACATTTCAAATGAACCAAGGGAAC
ATCTAGAAGGACCATGCAAAGGCCCTATTGAACTTCAAATTCAAGCCATTTTGAAAGCACCTACGGACCCTAATGCAGTCAAGACTGGTGAATGG
TTAACAGTCAAAAAACT
ATCTAGAAGGACCATGCAAAGGCCCTATTGAACTTCAAATTCAAGCCATTTTGAAAGCACCTACGGACCCTAATGCAGTCAAGACTGGTGAATGG
TTAACAGTCAAAAAACT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E547460] | SGN-U574366 | Tomato 200607 | Build 2 | 34 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T348335 [Download][View] | Facility Assigned ID: TUS71F16_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.948 | Expected Error Rate: 0.0429 | Quality Trim Threshold: 14.5 |
Working
