EST details — SGN-E547298

Search information 
Request: 547298Match: SGN-E547298
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C194548Clone name: TUS-71-B18
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C103465 [cLPP-10-N8] Trace: SGN-T176175 EST: SGN-E362419 Direction: 5' Facility: TIGR
Clone: SGN-C194548 [TUS-71-B18] Trace: SGN-T348174 EST: SGN-E547299 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E547298Length: 380 bp (926 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E547298 [] (trimmed) CGTTATTTGTCAAAGTCTGTTGTTATTTGTCTTTAAAATTCATGAATATGTACAAACTCAGTAACATAAAATGATTAGAATTCAGCACTCGTGAG
TTTTTAAATCATGATTCCACCTCTGTGACAGTTTGAGCAAACACAAATGTTAGAAGGAACTAACAGATGATGATCTCCTGCCAAATCCCATTTTA
GAACGGGACCCTTTTAAAGCTTTTGCATACTTCAGCAATTCTGCTTTCTCAGGCTCATTTTTACTTGTGTTCTCTTGAGGTGAATCCAATCTTCT
TGAACCTGACGACGAACCCCCATCACTATTTTGCCTACTATTCATCTGATAGTTGTTGTTTTCTCCTAATTTGCCGCTCCTTGAACCTTGAGACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E547298] SGN-U574618 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T348173 [Download][View] Facility Assigned ID: TUS71B18_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read -- flanking 5' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.935 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5