Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E545606

Search information 
Request: 545606Match: SGN-E545606
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C193563Clone name: TUS-68-I17
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C99589 [cLEZ-18-F22] Trace: SGN-T123596 EST: SGN-E311381 Direction: 5' Facility: TIGR
Clone: SGN-C193563 [TUS-68-I17] Trace: SGN-T346482 EST: SGN-E545607 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E545606Length: 292 bp (912 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E545606 [] (trimmed) AATGAAAATCCATTTTTCTTCACCTTAGCTCGTGAATGAGTTCTCCACATAAACCAAAGAGGCCTTTTTTTCAAAATTCACTACACATAATGAAG
AATGAAAAGATAAATAACCCAGACAAGTTGGCCAATAATAGCGCCCTCTAATGTACAGTTTGTTATAACAATAAACATAATTGGTCTGCAGATAC
TACCGATACTCCACCAGCACATACAATGGCTTGCCATTCAACTTCTCCTTACCCTTTAGTTCTGGTATTTCAATCACACATGCACATTCAACCAC
TTCTGCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E545606] SGN-U578605 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T346481 [Download][View] Facility Assigned ID: TUS68I17_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5