EST details — SGN-E545191
| Search information |
| Request: 545191 | Match: SGN-E545191 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C193321 | Clone name: TUS-67-O15 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C100355 [cLEZ-7-J18] | Trace: SGN-T121982 | EST: SGN-E307968 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C193321 [TUS-67-O15] | Trace: SGN-T350041 | EST: SGN-E549166 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E545191 | Length: 286 bp (912 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E545191 [] (trimmed)
GAAATCACTTACCAGAGACGAAGACGAGGAGGCACTAAAGATCATAGTGGATCAGCAGCACCTGCCAATTCCGTTAAAGATGTAGTTCGTGTCAC
CAAAATAATAAGTGAGTCATCAGAATATGAAGGTGATTCGTCCTGGCTCCAATACTGCACTCCATAGTTTAGAATTTCAGCTATAGACGAAAAAT
GTACGCTCCTTTAACCTCATGAGACCCCATCAATTGTCCATTCCCCTGTCTTGTACTCCATTTCATTATTGATTTATTGATCTTGAGTTCCTGGT
T
CAAAATAATAAGTGAGTCATCAGAATATGAAGGTGATTCGTCCTGGCTCCAATACTGCACTCCATAGTTTAGAATTTCAGCTATAGACGAAAAAT
GTACGCTCCTTTAACCTCATGAGACCCCATCAATTGTCCATTCCCCTGTCTTGTACTCCATTTCATTATTGATTTATTGATCTTGAGTTCCTGGT
T
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E545191] | SGN-U584772 | Tomato 200607 | Build 2 | 2 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T346066 [Download][View] | Facility Assigned ID: TUS67O15_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.919 | Expected Error Rate: 0.0000 | Quality Trim Threshold: 12.5 |
Working
