EST details — SGN-E543961
Search information |
Request: 543961 | Match: SGN-E543961 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C192605 | Clone name: TUS-66-A19 |
| ||
Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C93730 [cLEX-15-I7] | Trace: SGN-T117879 | EST: SGN-E305393 | Direction: 5' | Facility: TIGR |
Clone: SGN-C192605 [TUS-66-A19] | Trace: SGN-T349839 | EST: SGN-E548964 | Direction: 3' | Facility: INRA (MWG) |
Sequence |
Sequence Id: SGN-E543961 | Length: 173 bp (885 bp untrimmed) |
Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E543961 [] (trimmed)
GATCAATATGGGTAAGGAGAATGTTCACGTAAACTTGGTCGTCATTGGACACGTCGACTCCGGCCAGTCCACCACCACTGGTCACTTGATCTACA
AGTAATGTGGCATGGACAAGCGAACCATCGAAAAGTTCGAGAAGGAAGCCAAGGTAATGGGCAATTCCTCCTCCTAGT
AGTAATGTGGCATGGACAAGCGAACCATCGAAAAGTTCGAGAAGGAAGCCAAGGTAATGGGCAATTCCTCCTCCTAGT
Unigenes |
Current Unigene builds | |||||
[SGN-E543961] | SGN-U593707 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T344836 [Download][View] | Facility Assigned ID: TUS66A19_Q1 |
Submitter: Koni | Sequencing Facility: INRA (MWG) |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.991 | Expected Error Rate: 0.0440 | Quality Trim Threshold: 14.5 |