EST details — SGN-E543961
| Search information |
| Request: 543961 | Match: SGN-E543961 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C192605 | Clone name: TUS-66-A19 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C93730 [cLEX-15-I7] | Trace: SGN-T117879 | EST: SGN-E305393 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C192605 [TUS-66-A19] | Trace: SGN-T349839 | EST: SGN-E548964 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E543961 | Length: 173 bp (885 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E543961 [] (trimmed)
GATCAATATGGGTAAGGAGAATGTTCACGTAAACTTGGTCGTCATTGGACACGTCGACTCCGGCCAGTCCACCACCACTGGTCACTTGATCTACA
AGTAATGTGGCATGGACAAGCGAACCATCGAAAAGTTCGAGAAGGAAGCCAAGGTAATGGGCAATTCCTCCTCCTAGT
AGTAATGTGGCATGGACAAGCGAACCATCGAAAAGTTCGAGAAGGAAGCCAAGGTAATGGGCAATTCCTCCTCCTAGT
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E543961] | SGN-U593707 | Tomato 200607 | Build 2 | 1 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T344836 [Download][View] | Facility Assigned ID: TUS66A19_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.991 | Expected Error Rate: 0.0440 | Quality Trim Threshold: 14.5 |
Working
