EST details — SGN-E542420
| Search information |
| Request: 542420 | Match: SGN-E542420 |
| Request From: SGN database generated link | Match Type: EST sequence internal identifier |
| Clone information |
| SGN ID: SGN-C191710 | Clone name: TUS-63-L12 |
| ||
| Library Name: TUS | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
| Additional sequencing |
| Clone: SGN-C89782 [cLEW-19-H18] | Trace: SGN-T113592 | EST: SGN-E302168 | Direction: 5' | Facility: TIGR |
| Clone: SGN-C191710 [TUS-63-L12] | Trace: SGN-T343292 | EST: SGN-E542417 | Direction: 3' | Facility: INRA (MWG) |
| Sequence |
| Sequence Id: SGN-E542420 | Length: 177 bp (975 bp untrimmed) |
| Status: Current Version | Direction: 5' [See links to 3' reads above] |
>SGN-E542420 [] (trimmed)
GCTAAAACCCAAAGGAAGAAAAGAAAATCGCCTCTTTCTGTCAATTTCATCTCACAATCTCGCATTTTCTCTCAGTTTTTCTCTTATACTCGCCT
TACCCATGGCTCTACTCGGTGAGAAGACCACCTCTGGCCGCGAGTACAGGTGAAGGACATGTCCCATGCTGACTTCGGCAGG
TACCCATGGCTCTACTCGGTGAGAAGACCACCTCTGGCCGCGAGTACAGGTGAAGGACATGTCCCATGCTGACTTCGGCAGG
| Unigenes |
| Current Unigene builds | |||||
| [SGN-E542420] | SGN-U577742 | Tomato 200607 | Build 2 | 274 ESTs assembled | |
| Follow SGN-U# link for detailed information and annotations | |||||
| Chromatogram |
| SGN-ID: SGN-T343295 [Download][View] | Facility Assigned ID: TUS63L12_Q1 |
| Submitter: Koni | Sequencing Facility: INRA (MWG) |
| Quality processing |
| Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
| Sequence Entropy: 0.967 | Expected Error Rate: 0.0347 | Quality Trim Threshold: 14.5 |
Working
