EST details — SGN-E542122

Search information 
Request: 542122Match: SGN-E542122
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191538Clone name: TUS-63-E8
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
See unigene SGN-U575339 for alternative clones/ESTs which are mapped
Additional sequencing 
Clone: SGN-C89032 [cLEW-11-G3] Trace: SGN-T112775 EST: SGN-E299935 Direction: 5' Facility: TIGR
Clone: SGN-C191538 [TUS-63-E8] Trace: SGN-T349537 EST: SGN-E548662 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E542122Length: 367 bp (939 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E542122 [] (trimmed) GGAACTGGAGATGATTTTGATTTATACCAAACAAGTAAGTAAAAGAAGAAAATTTGGGTTGTTGCCAAGTCAATTTTCTTCTATCAATCCCTAAT
TGAAGTATGAAATACAATATTTGTCTGCAGGGTATGCTAAAAAAGCAACATTTTCATCCGTTTGCACACTAACTTAACTTAATAAAAACAAATGG
GAAAATATAATTAATAACTTGAAAGAATTACATGAATCAAAGTTTTCCCTCCTTTGATTGTATTAAAGGAAAAAAGTACCCTCAGGGTTATGGGG
TAGAAAATTATGAGCAATAGCATCCCTTGGAAGCCTAGAATTGGTCGATCTCAATTGAATCTCTGGAAGCATTTCATCATCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E542122] SGN-U575339 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342997 [Download][View] Facility Assigned ID: TUS63E08_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.909 Expected Error Rate: 0.0086 Quality Trim Threshold: 20.5