Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E541698

Search information 
Request: 541698Match: SGN-E541698
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191291Clone name: TUS-62-K1
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C87315 [cLET-45-P19] Trace: SGN-T111647 EST: SGN-E300475 Direction: 5' Facility: TIGR
Clone: SGN-C191291 [TUS-62-K1] Trace: SGN-T342575 EST: SGN-E541700 Direction: 5' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541698Length: 430 bp (975 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E541698 [] (trimmed) CCCGCGTCGAGACGGTAGGTTCCTAAATGTTGTTGTTCTACCTCCCTTAATCGGATAAGGAGTTATATCTATTTGACTGACCTTAACATCATAGT
TGGCCTTTTTATTGCAATAATCGAAATCGGTGGATTTAGAGAGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTTGCTAGAAATGGCGACAAA
TTCTTTTATGTCTCAACACTTATTGTCAAAAGAAAAAATGCTTCAATTCAATGGCAGTCCAACTCTAACATTCCACAGCTAAACTTCCGGAAAAA
ATAAATCAAGCTACAAAAAGGAAACCTTCACTCTCCTTTTGAGTATACCATCGTTAAGCAACAGCTCCTACGCAAGTAGTTACTGGAGCATCACT
ATTTTGTTTTGCACCACTATATTTCTTGGTGATGAATCTGAAAAAATTCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541698] SGN-U593201 Tomato 200607 Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342573 [Download][View] Facility Assigned ID: TUS62K01_P1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: Multiple cloning site sequence detected -- chimeric clone suspected.
Passed all screens and filters
Sequence Entropy: 0.955 Expected Error Rate: 1.0000 Quality Trim Threshold: 14.5