EST details — SGN-E541254

Search information 
Request: 541254Match: SGN-E541254
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C191031Clone name: TUS-61-P5
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C83423 [cLET-24-K14] Trace: SGN-T108738 EST: SGN-E296221 Direction: 5' Facility: TIGR
Clone: SGN-C191031 [TUS-61-P5] Trace: SGN-T342126 EST: SGN-E541251 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E541254Length: 364 bp (872 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E541254 [] (trimmed) GTAGCTATGGCGAAGAACAGAAACAAGAAGAAAAACGGCCTAGCTGCCATGGATGTCTCCACTGACCAGACGGTCATGGATGCCCAAGCGATGGA
TACTTCAGAATCAGCTGCTCCAAAACCACATATAGGTGGATCACTTAGAAAGACGAAGGGAGTACAAATGAAAAGGACGAAGAATGTTAGGAAAA
AGAAGGCCATGGCAAAGGCTATTTCAAAAAGTGAGAAATTGGAGGAAAGAATCACTAGGAGTGAAAGCAAGATAGAGAGAACTAAAAATGCCAAA
CAGTTATACGAATGAATGGCTGAATGATATATTTTTTCCCTTTTCTGATTACTTATGAATGAAATGATTTTGATTTGTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E541254] SGN-U576960 Tomato 200607 Build 2 4 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T342129 [Download][View] Facility Assigned ID: TUS61P05_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.924 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5