Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-E539991

Search information 
Request: 539991Match: SGN-E539991
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C190296Clone name: TUS-60-A14
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C79335 [cLES-8-J19] Trace: SGN-T99167 EST: SGN-E288647 Direction: 5' Facility: TIGR
Clone: SGN-C190296 [TUS-60-A14] Trace: SGN-T349186 EST: SGN-E548311 Direction: 3' Facility: INRA (MWG)
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E539991Length: 527 bp (868 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E539991 [] (trimmed) GTTTCGCAAAAGGCAGTCGCTTCCCTCCCATCCATAGGGGAAGATTTTGACCAAAGAACTCAGTCAATAATTGCAAAATCAAAACTGAAGTCAGA
GATCCGGTTCAAGGCGGAGGTCGTTTCACCTGCAGAGTGGGAAAGGTGGATAAGGGATCAACAGAAGTCTGAAGGTGTTACTCCTGGTGAAGATG
TCTACATTATACTTCGTCTAGATGGTCGTGTTCGACGATCAGGAAAGGGGATGCCTGACTGGGCTCAAATTTTAAAGGAACTGCCTCCAATGGAA
GCAATATTAAGCAAGCTAGAAAGATAATACAAGTTCCTCTTGCTGAGTGCTAAAATCTTTTCACTACCTGGTGTATTTTCGGTCAGTCTCCTTAC
TTGAAATATAAAAGGCACTAATTGATGCCTGTTGAGCTTGTCTGTTTTACGTTTCCATTTTTTCACGAACATATACTGTACTATAATTCTATAAA
TTGATATTGATATTTGCCAGATGAATATCCAAAGGATATGAAATCCCATAGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E539991] SGN-U567448 Tomato 200607 Build 2 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T340866 [Download][View] Facility Assigned ID: TUS60A14_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.966 Expected Error Rate: 0.0000 Quality Trim Threshold: 12.5