Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E538052

Search information 
Request: 538052Match: SGN-E538052
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C189119Clone name: TUS-56-P13
cartOrder Clone
Library Name: TUSOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: Rearrayed collection of L. esculentum cDNA clones
Development Stage:

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C46645 [cLEI-13-D24] Trace: SGN-T82500 EST: SGN-E268439 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E538052Length: 439 bp (975 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E538052 [] (trimmed) GTAACTTTAAGAGCTCTTATCATTACTTGGTTAAAAGGAGAAAATAATAGAAAAGCTTGTGCACTCATATCTCTAACAGGCAGTGAGTACTGAGT
AGTGGTTTTTAAGCACCAGCACCACTGTTATCTTAATTTATTGGATTAGCAGAAACGAGATCAATTTCATTCTTAGTTTTAAAACTTCTTGTGGG
TGTTGGTGGTCCTTTGTGTCTTGATACTTTTTAATTATGTTTTATTTGGGCTGGGGGATTCATTTTGGATTTGCACTGCTTCATTTTTCTGAGCA
TGCTCCAACCATCTGTTTTTAGATTTTACGATAGACCACATTCATAGTGCTTATGTGATTTTTTTCTGTCACAACTTGCTGTTGAGTTGCAGATC
GGTATAACACCGCCCTCGTTTGCCACAGATGGCGATTCTTGACATGCCATCCTCCGCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E538052] SGN-U582110 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T338927 [Download][View] Facility Assigned ID: TUS56P13_Q1
Submitter: Koni Sequencing Facility: INRA (MWG)
Funding Organization: INRA
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5