Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E526353

Search information 
Request: 526353Match: SGN-E526353
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C326194Clone name: Petunia-C2H4-6-G05
nocartOrdering Not Available
Library Name: Petunia-C2H4Organism: Petunia hybrida

Tissue: all floral organs
Development Stage: anthesis

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C326194 [Petunia-C2H4-6-G05] Trace: SGN-T333644 EST: SGN-E526257 Direction: Unknown Facility: U Fla ICBR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E526353Length: 192 bp (660 bp untrimmed)
Status: Current VersionDirection: Unknown
>SGN-E526353 [] (trimmed) AATTTATATAATTGCTTCTACTATACTTTCGTCAAGACCCTAATGAACCAATAATAAATAGGACTATCTTTTCTGATTTCATTGATCTGTTCCTC
CTGTTGAAATATGGTCTTATCAACACATGCATGTATTCCCATTAGTATAATCAAAATGCTTAAGAAGTACGTAAAAAAAAAAAAAAAAAAAAAAA
AA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E526353] SGN-U208151 Petunia hybrida Build 1 3 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T334124 [Download][View] Facility Assigned ID: Petunia-C2H4-6RR-G05.g
Submitter: Dave Clark Sequencing Facility: U Fla ICBR
Funding Organization: USDA; AFE; FCGFI; FF
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.895 Expected Error Rate: 0.0009 Quality Trim Threshold: 12.5