EST details — SGN-E526353
Search information |
Request: 526353 | Match: SGN-E526353 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C326194 | Clone name: Petunia-C2H4-6-G05 |
| ||
Library Name: Petunia-C2H4 | Organism: Petunia hybrida |
Tissue: all floral organs
Development Stage: anthesis
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
Clone: SGN-C326194 [Petunia-C2H4-6-G05] | Trace: SGN-T333644 | EST: SGN-E526257 | Direction: Unknown | Facility: U Fla ICBR |
Sequence |
Sequence Id: SGN-E526353 | Length: 192 bp (660 bp untrimmed) |
Status: Current Version | Direction: Unknown |
>SGN-E526353 [] (trimmed)
AATTTATATAATTGCTTCTACTATACTTTCGTCAAGACCCTAATGAACCAATAATAAATAGGACTATCTTTTCTGATTTCATTGATCTGTTCCTC
CTGTTGAAATATGGTCTTATCAACACATGCATGTATTCCCATTAGTATAATCAAAATGCTTAAGAAGTACGTAAAAAAAAAAAAAAAAAAAAAAA
AA
CTGTTGAAATATGGTCTTATCAACACATGCATGTATTCCCATTAGTATAATCAAAATGCTTAAGAAGTACGTAAAAAAAAAAAAAAAAAAAAAAA
AA
Unigenes |
Current Unigene builds | |||||
[SGN-E526353] | SGN-U208151 | Petunia hybrida | Build 1 | 3 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T334124 [Download][View] | Facility Assigned ID: Petunia-C2H4-6RR-G05.g |
Submitter: Dave Clark | Sequencing Facility: U Fla ICBR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.895 | Expected Error Rate: 0.0009 | Quality Trim Threshold: 12.5 |