Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E519736

Search information 
Request: 519736Match: SGN-E519736
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C311492Clone name: cSML-8-H21
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C311492 [cSML-8-H21] Trace: SGN-T320610 EST: SGN-E519737 Direction: 3' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E519736Length: 388 bp (628 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E519736 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAATTGATTATTGACAAATGTCTTCATACAAAAGACTGAAGGAGTGTACAAGATTAATTGGGCAA
TGGAGAAGAAAGCTTCCAGCTGAAGCTTTATTTGTTCAGATGTCCTTTCAGCTATTCTAGATTGTAAGAAAACAGCAATGTAGAAACTGGTTTCT
GCTATTCCTCTTCCTCACCAGTAATCTTTTTCTTAAGAGCTTGAACATCACTTGCTAGTTCATCCCTTCCACTCTTGAAGAGAATGTATCTGTAG
ATGAACCATACAAAGTATCCAAGCCCAACCAACTCCAAAAACTTGGGTAACAGAGGTATGGAGTCTAATGCATCAGCAACGATTGAAGATAACCA
AAGACCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E519736] SGN-U207291 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T320609 [Download][View] Facility Assigned ID: cC-smflcSML8H21c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0152 Quality Trim Threshold: 20.5