Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E518467

Search information 
Request: 518467Match: SGN-E518467
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310533Clone name: cSML-5-D13
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310533 [cSML-5-D13] Trace: SGN-T319339 EST: SGN-E518466 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518467Length: 476 bp (656 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E518467 [] (trimmed) TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTAGGACTGGGGAAGATTTACTATATATTCGAAAGAAGTAATTTTTAACCAACATACGCG
GTATTATTTTCTATATACACGGCGTAATATTCCAAGGAAGGGTGTTTATCCGACTACCCTTCAGTCTATGTAGCTATGCCACTGACTAGGTGACA
CATCGACACGGATATGTTTAACGTAAGACAATAATGGTATGGTATGAGTGACAGCAATGGTAAAGTTAAGTTAGTCTGAAGTGACTTTCACCTCA
GAGGGGACTAAGTGCACAATTTTGAAGGCATCAGATGTCCCTTAAAGCTTTGAGGCAGTAGCTGTTGTTCTGCTCAAGGCAATAGCAGCCTTAGA
ACCAGAAGGACGACCCAAATGTTTGCAGATGAAATCTCCAGCCAATAGAAGCTTTCTCATATCCACATTTGTCTTCACTCCTAGTCCATTGAGCA
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518467] SGN-U206771 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319340 [Download][View] Facility Assigned ID: cC-smflcSML5D13d1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5