EST details — SGN-E518216

Search information 
Request: 518216Match: SGN-E518216
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310396Clone name: cSML-3-P23
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310396 [cSML-3-P23] Trace: SGN-T319090 EST: SGN-E518217 Direction: 5' Facility: Cereon
Clone: SGN-C310396 [cSML-3-P23] Trace: SGN-T319091 EST: SGN-E518218 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518216Length: 160 bp (583 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E518216 [] (trimmed) TTGATATTGATACTGATACGTAACAGAGACTGAACAAGAAACAAGACAAAGACTAATGGTGAGGACAGAAAGTGAGGACGTTGCTGCTGCCAGTG
CAAGTGGCAATACTAGTGGGATCATCGTAAGCATATGAATAAGCTCTGGGGCAAGCAGTTTTGAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518216] SGN-U205976 Solanum melongena Build 2 2 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T319089 [Download][View] Facility Assigned ID: cC-smflcSML3P23a1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.936 Expected Error Rate: 0.0207 Quality Trim Threshold: 20.5