EST details — SGN-E518119

Search information 
Request: 518119Match: SGN-E518119
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C310350Clone name: cSML-3-N11
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C310350 [cSML-3-N11] Trace: SGN-T318990 EST: SGN-E518117 Direction: 3' Facility: Cereon
Clone: SGN-C310350 [cSML-3-N11] Trace: SGN-T318991 EST: SGN-E518118 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E518119Length: 464 bp (629 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E518119 [] (trimmed) TTTTTTTTTTTTTTTTTTTGAATGCATGCACGAGACATATACTAAAGAAGATAGATAAATTATCAAGATTTGGTTAATGTAGCACAACCCATCGC
ATGAAGTTACAATACAAGACTTGACTACTTACGATCCCAAAAGACACAAAGAAACAACGAAAAATACAACATAGACATAATAGATCCATAAGCAG
GATCACACTCCATCAATCTTATTCTTAATTTTCCTCATGGCACCAAATAATGAAGATCAGCCTTACTGAATCGTGGAGCAGTCAGTAGAGGGGCT
GATCTTGTAAGGGATGTTAACTCCACAAGCACTAGGGAGACCAGCAGCTTTACCCAAATCAATTCCCTTCATAGCATTAGCTGCCGATTTTAGGC
AATTGCATACTGTTTTTCGATCTGCTGTGGTCTTGGCTTGAGCCAAGAGGCTCTTAACACCACCACAACAGCCTCCAAGAGCGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E518119] SGN-U205592 Solanum melongena Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T318992 [Download][View] Facility Assigned ID: cC-smflcSML3N11c1
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.967 Expected Error Rate: 0.0130 Quality Trim Threshold: 14.5