Notice: We have moved solgenomics to a new server and hosting system which caused some instability over the last few days. We apologize for any inconvenience.

EST details — SGN-E515080

Search information 
Request: 515080Match: SGN-E515080
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C308673Clone name: cSML-12-B10
nocartOrdering Not Available
Library Name: cSMLOrganism: Solanum melongena

Tissue: buds & flowers
Development Stage: anthesis-stage flowers, 4-8 week old plants

There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C308673 [cSML-12-B10] Trace: SGN-T315952 EST: SGN-E515079 Direction: 5' Facility: Cereon
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E515080Length: 201 bp (832 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E515080 [] (trimmed) CTCTAAAGATCAACAAAGATAAAACTGCCTGCTTGGCTTCAGCCCTCACACAAAAGTGAAAAGCCAAGTGATTACAACATCTGATTCCAAAATTG
AAACGACCACCAAGACTAACATGGCAGGAACCTAAGAGAAGCTCGAACTAGTAGGTGCACCACCACCAAAACCTCCAGACCCACGGCCAAATCCA
GGTCTTCCACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E515080] SGN-U206203 Solanum melongena Build 2 1 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T315953 [Download][View] Facility Assigned ID: cC-smflcSML12B10d2
Submitter: Koni Sequencing Facility: Cereon
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.913 Expected Error Rate: 0.0192 Quality Trim Threshold: 20.5