Notice: the solgenomics has been unstable, we apologize for the inconvenience.

EST details — SGN-C5074

Search information 
Request: 5074Match: SGN-C5074
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C5074Clone name: cLEC-30-H3
cartOrder Clone
Library Name: cLECOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: combined undifferentiated and shooting callus
Development Stage: 7-10 days post germination

Microarray: Alias clone SGN-C183937 is on microarray TOM1: SGN-S1-1-2.4.19.21
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183937 [TUS-43-H15] Trace: SGN-T1796 EST: SGN-E378623 Direction: 5' Facility: Giov. Lab
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E207075Length: 525 bp (870 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E207075 [] (trimmed) CCAACTTCATATACGATGGGAATTCCTTTGCAAATGGTCCAGCTCCTCCCCCACCACCATACACTGCACCTCCTCCTGGAAGATCTCGCCACAAC
CGTAGCCATTCTCCTCCTAGTTCACGTACAAGACCAGGTTCTGATGGCCCCCCATCTCCAGAAAATGGTGATAAAAAGAAGGGATTGACAACTGG
AGCTATCGTTGGCATAGCTCTTGGATCTTCTCTTGCAATTCTTTTTGCTCTGGTAGCACTTGTATTTTGCTTCCGGAGGGGCAAGGGCAAGGAAA
TTGCTACAAGACCCTCTACAGGAAGTCTTCCAGTTGGCACAGATAAAGTGAATATGGAGGTACAAGAGCAAAGGGCGAAGCCTGTGGTTGCTGTT
GCTGACTTGAAGCCCCCACCTACCGAAAAGGTGACTGTTGAAATGATACAAGGAAAGAATGGATCTGTCAGGAGAGTGAAGTCTCCAATAACTGC
ATCTGCTTATACTGGTGCTGCATTGCAAACAGCAACAAACAGCTTCAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E207075] SGN-U584655 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T29071 [Download][View] Facility Assigned ID: TCAEO38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0108 Quality Trim Threshold: 14.5