EST details — SGN-C45907

Search information 
Request: 45907Match: SGN-C45907
Request From: SGN database generated linkMatch Type: cDNA clone internal identifier
Clone information 
SGN ID: SGN-C45907Clone name: cLEG-9-L5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C182522 is on microarray TOM1: SGN-S1-1-1.1.8.20
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182522 [TUS-39-M16] Trace: SGN-T194904 EST: SGN-E393578 Direction: 3' Facility: INRA
Clone: SGN-C182522 [TUS-39-M16] Trace: SGN-T194904 EST: SGN-E398827 Direction: 3' Facility: INRA
Clone: SGN-C182522 [TUS-39-M16] Trace: SGN-T195267 EST: SGN-E393941 Direction: 3' Facility: INRA
Clone: SGN-C182522 [TUS-39-M16] Trace: SGN-T195268 EST: SGN-E393942 Direction: 5' Facility: INRA
Clone: SGN-C182522 [TUS-39-M16] Trace: SGN-T200134 EST: SGN-E398828 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E251466Length: 587 bp (1031 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E251466 [] (trimmed) TCAAACCTATACAAAATAGGAACAAATTTGAAGAGAAAAAAATAAAAAAAAATCTCTAAGTTTTTTTTTTCTTCTTTTCGATACAAGACGATATG
GTTTTTCCTATTAATCAGGAATTACTTGTCGATGAGTCGTCTTCTCAGTTGAGAAAAACAAGTGGAGGAACTGGTGGAGGAGGTAGAGGGAAGAT
TGAAATTAAAAGGATCGAAAATACGACAAATCGACAAGTTACGTTCTGCAAGCGTAGAAATGGGCTATTGAAAAAAGCTTATGAACTTTCTGTTC
TTTGTGATGCTGAAGTTTCACTAATTGTATTTTCCAGCCGCGGCCGTCTCTATGAATATGCCAATAACAGTGTTAGGGCAACTATTGATAGGTAC
AAGAAACACCATGCTGATTCCACTAGTACTGGATCTGTTTCTGAAGCTAACACTCAGTACTACCAGCAAGAAGCATCCAAACTGCGACGACAAAT
TCGAGATATACAGACTTATAACAGGCAAATAGTTGGAGAGGCATTGGGCAGTTTAAGCCCTAGAGACCTCAAGAATTTGGAAGGGAAACTTGAAA
AGGCCATTGGTAGAGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E251466] SGN-U581068 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T65549 [Download][View] Facility Assigned ID: TBFBI63TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5